Here we go again. 200 comments coming right up.

On the contrary, Ace, me thinks that someone doth protest too much.

This falls into the "well, duh!" category. ID is a silly-assed mishmash of Christian Creationism and pseudoscientific hand-waving. Goodbye and (hopefully) good riddance.

I guess it depends on who you read for your information on ID. The people I've read sound scientific and disavow Creationism.

You know, ID would completely go away if somebody could show how, through random mutations, a bacteria flagella could form. That would kill ID where it stood. And by "show", I don't mean "demonstrate how a bacteria adapts to its environment and then hand-wave in flagellum".

My opinion on this is: evolution occurs, but Man shows no evidence of it. 1776? Thomas Jefferson. 1976? The Jeffersons. Case closed.

Monty, this is a subject where you and I are in total agreement. ID is creationism dressed up to look scientifical by people who don't understand what science is or how it works. It's total claptrap, and as such I have no problem with teaching it in a philosophy course. Just keep it out of the science classroom.

That's my $.02 on the subject. Now I'll be quiet and watch this thread creep toward the 200 mark.

ID is "claptrap" (great word) for the simple fact that there are no gods, supreme beings or designers.See how easy that was?
A little gas for the fire.

ID is "claptrap" (great word) for the simple fact that there are no gods, supreme beings or designers

Oh yeah? What about Dick Cheney?

If Dick Cheney created the world, why do I have such a small penis?

Riddle me that, Slublog.

Slublog,
Let me get back to you on that...
I have to think now...

Uh Rho, evolution doesn't happen over a period of 200 years, which may seem like a lot in human history, but is not even the width of a piece of hair in the history of time (if time=1 mile). Take, for example, the Cambrian explosion, which biologists cite as the time when single celled organisms evolved into multiple celled organisms. Know how long that took? 10 MILLION years. Two hundred years is such a small period of time as to be totally insignificant; thus, your point is well, pointless.

If you read the court's summary and decision, you can see how it very carefully traces the development of ID from creationism to "scientific creationism" to ID, and exposes the charlatan proponents of ID for what they are: dishonest purveyors of creationism.

If Dick Cheney created the world, why do I have such a small penis?

You have not yet reached the level of understanding necessary to learn such truths.

But if you sign up for my $25,000 workshop on the Cheneyology, all answers will be provided.

If I take you up on that, Slublog, Katie Holmes had better be part of the package.

At least Katie Holmes. As an alpha male Cheneyologist, I only plan to date 8s and above.

You know, ID would completely go away if somebody could show how, through random mutations, a bacteria flagella could form. That would kill ID where it stood. And by "show", I don't mean "demonstrate how a bacteria adapts to its environment and then hand-wave in flagellum".

I've read about this proposed experiment, and supposedly it would only take about two years to reach a definite conclusion. Either "side" could do it and prove the other wrong, but no one has stepped forward.

Wouldn't that make a great project for a post-graduate? You could be in your 20s and see your name alongside Darwin's. Talk about grant money potential, all because of watching germs swim around doing what they do.

I DON'T KNOW WHAT WE'RE YELLING ABOUT!

Oh, no. For the Cheneyology course that includes Ms. Holmes, it's gonna set you back $75,000.

Deal of a lifetime, if you ask me.

Slublog,
do you have a paypal account? Tell Katie to wear black, or nothing.

ID may not be good science
but nothing in the constitution mandates good science in public schools

"Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof;"

if twisting that around to allow courts to control what a school board can decide to put in the curriculum isn't judicial activism than nothing is

I think our country should be all about the Arena Of Ideas. Let the best ideas win. Federal judges telling teachers what they can and cannot say is a clear violation of the first amendment.

"Shut up", the judge explained.

I'm opting for the Katie wearing nothing class. Oh crap, my wife probably won't let me have the funds for that course. Then again, if you add a Jello-covered Naomi Watts to mix, I might be willing to take out a loan. If Katie agrees to slather on the Jello, I might be willing to sell my house. If Katie agrees to then lick it off of Naomi, I'll start a permanent draft from my paycheck.

Hey, it's an elective. I get to choose what kind of course I want.

If someone could make a case for Intelligent Design as a naturalistic process, then that would be testable with the (natural) means at our disposal.

Say that research into the genome uncovered this intron:
CAGAGCAGGAGCCAGCGAGGCAGGGAGCCC
Compare with:
0-1-10-11-100-101-110-111-1000
0-1-2-3-4-5-6-7-8

The probability of that sequence showing up in DNA anywhere is low (slightly less than one in a million, in any given stretch of 30-character DNA). It could be a signature of some being who knew binary code and DNA. It would be worth explaining how it came about. If its nearest genetic relatives have different code in there instead, which is consistent, then that is strong evidence that someone put it there. Intelligent design, in short.

That's just one example. If anyone would propose a physical test which would prove a designer, that would be science; if they would prove it, then we'd then be able to get into the science of what did this, when, and why.

But no-one's done that. Instead we have attempts to define away science so it includes "supernatural" stuff, untestable by design. This is fraud. Fraud angers me, and it should anger religious people too. That it doesn't seem to anger more Christians makes non-Christians suspicious of them.

"When a man lies, he murders a part of the world" - Merlin

I think there's a very good debate to be had about ID, but this isn't it.

/GrouchoMarx

Evolution is a religion and is religiously indoctrinated in all schools. So if you're under 55, chances are you are an inbred believer of something one atheist proposed as his "solution" to the God he hated. I could care less what a proponent of evolution thinks...the thinking is bassackwards. Science has a theorem that can be proven.
There is plenty of theory and nil proof of evolution. Yet science it is because Kool-Aid is plentiful.

I'm not quite sure where the asinity of the anonymous poster who wrote, "Evolution is a religion and is religiously indoctrinated in all schools" ends, so let's lay down some basic facts explaining why evolution is not a religion (and why claiming so is a surefire way to let everyone around you know that you're a creationist).

1. Evolution is the backbone of modern biology. Without it, biology flat out does not make sense.
2. Evolution is a "theory" but not in the dishonest sense that ID proponents use it; ie, as something that isn't necessarily true, like Marxism or third generation feminist theory. Here, ID proponents capitalize on the ignorance of most Americans by using a layperson word like "theory" to occlude its different meaning in science.
Evolution is a "theory" in the same way that all things in science are theories: It is true to the extent that it can be proven, even if there are significant holes in it. So long as the body of evidence that supports it remains overwhelming, the theory is "true." Got a more convincing explanation? Show me. Even gravity is technically a "theory" though that hardly undermines its "truth."
3. The evidence for evolution is all around us. Darwin saw it for the first time on his trips to the South American islands where organisms adapted to different environmental factors on each island and the mainland. We have evolutionary traits as well, such as the goosebumps that are supposed to fluff up the fur that we no longer have, as well as the tailbone that stopped being necessary to our survival millions of years ago.
To simply disparage evolution as being a religion and to categorically say there is no proof of it is to put a big sign around you pointing out your willful ignorance.
All of this lukewarm defense of evolution does nothing to strengthen conservatism, and instead puts a handicap on learning science in this country. If ID was so convincing and evolution was so flawed, then surely ID would be convincing to others outside of some sects of the Christian community in the United States.

as well as the tailbone that stopped being necessary to our survival millions of years ago.

Why don't we still have tails? That would be cool.

LOUD! NOISES!

It would be pretty cool.

It's not going to work, Dave in Texas. That fuse can't be snuffed out, even with pure refined humor.

Two years. Name in all the textbooks. Money out the yingyang. I'd do it myself if my sons wouldn't contaminate the specimens with Cheeto dust.

Boy, that escalated quickly... I mean, that really got out of hand fast!

There is absolutly no intellegence in the 9th curcut court although their rejection of a stay of exicution for tookie williams was a good ruling

Well, the 9th Circuit was smart enough to realize that they didn't have jurisdiction over Dover, Pennsylvania. So they've got that going for them.

... which is nice.

(Also, I miscalculated the odds of getting that sequence in a DNA sequence. The odds of "knowing in advance" a 30-digit DNA sequence are 1/4 to the power of 30. That is a dot followed by 18 zeroes and then a nine. Loose. Sorry.)

Well, the 9th Circuit was smart enough to realize that they didn't have jurisdiction over Dover, Pennsylvania.

Spurwing's going to fix that soon after he becomes President.

President Plover. It's got a nice ring to it, don't it?

Better than "Senate Minority Leader Tubino."

Regardless of where you come down on the Court's ID decision, this judge is a moron who should be removed from the bench:
(from the District Judge's decision):
Rather, this case came to us as the result of the activism of an ill-informed faction on a school board

Damn those activist legislators!

Talk about a comment that shows how little you know about the subject on which you're speaking. This is right up there with the 40 year old virgin's comment about breasts feeling like sandbags.

The school board's role is to be activist. That's what legislatures are supposed to do. The fact that this US District Judge doesn't know that scares me. Want more evidence of an activist judge with an agenda? Here ya go (from his decision):

The breathtaking inanity of the Board's decision is evident when considered against the factual backdrop which has not been fully revealed through this trial.

So he knew how bad the Board's decision was regardless of what the evidence at trial showed. It's pretty straightforward, black letter law that the judge is confined to consider only the facts presented at trial. Judges shouldn't let their own experiences or biases affect their decisions, and they shouldn't be considering "evidence" they heard from outside sources.

This is exactly the type of activist crap that conservatives should oppose, regardless of whether we agree with his decision or not.

Note -- I'm not in favor of teaching ID as science in schools, but this is a democracy, and if the majority of people want their kids to learn it as science, I'll just correct that notion at home.

Yeah, there were horses, and a man on fire, and I killed a guy with a trident!

WTF is special about that sequence, Ross/Zim?

Evolution is a theory until such time as somebody shows me a fish turning into a puppy. Now get out of my face. I don't placate.

[just kidding around, btw.]

such as the goosebumps that are supposed to fluff up the fur that we no longer have,

You obviously haven't seen me with my shirt off.